New special offers are available!
Primers for Sequencing
Primers for Sequencing

100+ universal primers for sequencing. Free for customers using MCLAB's sequencing services.
           
MSDS          
Download Fasta File          
 
Primer Name & Sequence
Name Cat# Description Price Qty
MCLAB Primers
S-Primers
Please input your Primer Name and Sequence in the filed above.
$45.00

If you are using MCLAB's DNA sequencering services, you do not need to purchase or submit any primers listed here in your orders. You only need to specify the primer names in your order form and MCLAB will take care of everything related to these primers.

MCLAB Primers

MC Easy Depository™ for DNA Sequencing Guidelines
We provide custom oligonucleotide synthesis service in combination of our DNA sequencing service to better assist our customers. First time primer synthesis order will be fulfilled within 24 hours. Once the primers are synthesized, we aliquot them for the DNA sequencing and save the rest in the MC Easy Depository™for possible future usage from our customers. So that the next time when you order the sequencing using the same primers, you will save time and money by choosing the primers we saved for you in the MC Easy Depository ™. This is a complete free service from us to say thank to our customers.

We also provide our customers free templates and primers storage in MCLAB's freezer archives for up to 12 months from the time of submission. This way when you order a re-sequencing or submit other templates to be sequenced by the same group of primers, what you need to do is just tell us which primer combination to use. It's just like that easy.

Customers could also get their DNA templates and/or primers back by simply include such instructions in the online order form when submitting their sequencing requests to MCLAB. It's like that simple.

 

MC Free Primers™ for DNA Sequencing Service

# Primer Sequences (5'd ~ 3') Plasmid Manufacturer
128 glllGTATGGGATTTTGCTAAACAACPh.D. glllNew England Biolabs
1a -96 glll CCCTCATAGTTAGCGTAACG Ph.D. glll New England Biolabs
2 Ac5 Forward ACACAAAGCCGCTCCATCAG pAc5.1/V5-His Invitrogen
3 AD Reverse AGATGGTGCACGATGCACAG AD  
4 a-Factor TACTATTGCCAGCATTGCTGC Pichia (pMET) Invitrogen
5 AOX1 Forward GACTGGTTCCAATTGACAAGC Pichia Invitrogen
6 AOX1 Reverse GCAAATGGCATTCTGACATCC Pichia Invitrogen
7 AS HSV Tag Primer ATCCTCGGGGTCTTCCG pIEx Novagen
8 AS SoTag 18mer Primer GTCCATGTGCTGGCGTTC pIEx Novagen
9 AUG1 Forward CAATTTACATCTTTATTTATTAACG Pichia Invitrogen
10 AUG1 Reverse GAAGAGAAAAACATTAGTTGGC Pichia Invitrogen
11 Bac Forward TTTTACTGTTTTCGTAACAGTTTT pBlueBac4.5 Invitrogen
12 Bac Reverse CGGATTTCCTTGAAGAGAGTA pBlueBacHis2 Invitrogen
13 Baculovirus (+15)Reverse ACTTCAAGGAGAATTTCC pMelBac Invitrogen
14 BGH Reverse TAGAAGGCACAGTCGAGG Universal  
15 BK Reverse ACAGGAAACAGCTATGACCTTG BK virus  
16 BKRSV CGCCATTTGACCATTCA pBK-rsv  
17 Bluescript KS TCGAGGTCGACGGTATC pBluescript Stratagene
18 Bluescript SK CGCTCTAGAACTAGTGGATC pBluescript Stratagene
19 CBDcenA TCAACGGCACCACCTGCA   Novagen
20 CBDcexLEAD TAGGTGCAACTGTTGTTCTG   Novagen
21 CBDclos CAACACCAGTTGTAAATCCA   Novagen
22 cI Forward GGATAGCGGTCAGGTGTT pHybcI/HK Invitrogen
23 Cite primer GGGGACGTGGTTTTCCTTTG pCITE Novagen
24 CMV Forward CGCAAATGGGCGGTAGGCGTG Universal  
25 CYC1 Reverse GCGTGAATGTAAGCGTGAC Cyc1 Invitrogen
26 DsbA CGAGTATGCTGATACAGTGA DsRed Clontech
27 DsbC GAATTTCTCGACGAACACCA DsRed Clontech
28 DsRed1-C AGCTGGACATCACCTCCCACAACG DsRed Clontech
29 DsRed1-N GTACTGGAACTGGGGGGACAG DsRed Clontech
30 DsRed-C AAGAAGCCTGTGCAGCTACCAGG DsRed Clontech
31 DsRed-N CGCCTTCTATTTCAAACTCGTGCC DsRed Clontech
32 EBV Reverse GTGGTTTGTCCAAACTCATC EBV Invitrogen
33 EF-1a Forward TCAAGCCTCAGACAGTGGTTC    
34 EGFP-C CATGGTCCTGCTGGAGTTCGTG EGFP Clontech
35 EGFP-N CGTCGCCGTCCAGCTCGACCAG EGFP Clontech
36 GAL1 Forward AATATACCTCTATACTTTAACGTC Gal1 Invitrogen
37 Glprimer 1 TGTATCTTATGGTACTGTAACTG    
38 Glprimer 2 CTTTATGTTTTTGGCGTCTTCCA    
39 gp64 promoter CTACTAGTAAATCAGTCACACC    
40 gp64 Signal primer GCGCTATTGTTTTATATGTGC    
41 IE1 promoter primer TGGATATTGTTTCAGTTGCAAG pIEx, pBIEx Novagen
42 Lamdagt10For CTTTTGAGCAAGTTCAGGCCTGGTTAAG Lambda GT10 Promega
43 Lamdagt10Rev GAGGTGGCTTATGAGTATTTCTTCCAGG Lambda GT10 Promega
44 Lamdagt11For GGTGGCGACGACTCCTGGAGCCCG Lambda GT11 Promega
45 Lamdagt11Rev TTGACACCAGACCAACTGGTAATG Lambda GT11 Promega
46 M13 Forward (-20) GTAAAACGACGGCCAG Universal  
47 M13 Forward (-40) GTTTTCCCAGTCACGAC Universal  
47b M13 Reverse CAGGAAACAGCTATGAC Universal  
48 pUCR/M13 Forward CCCAGTCACGACGTTGTAAAACG pUC PGEM-T
PGEM-
49 pUCR/M13 Reverse AGCGGATAACAATTTCACACAGGAA pUC PGEM-T PGEM-
50 MT Forward CATCTCAGTGCAACTAAA pMT/V5-His Invitrogen
51 myc-His Reverse ATGACCGGTATGCATATTCAG    
52 OpIE2 Forward CGCAACGATCTGGTAAACAC pMIB/V5-His Invitrogen
53 OpIE2 Reverse GACAATACAAACTAAGATTTAGTCAG pMIB/V5-His Invitrogen
54 p10 Forward GTATATTAATTAAAATACTATACTG pTriEx-2 Hygro Novagen
55 pBAD Forward ATGCCATAGCATTTTTATCC E.coli araBAD Invitrogen
56 pBAD Reverse GATTTAATCTGTATCAGG E.coli araBAD Invitrogen
57 pCDM8 Reverse TAAGGTTCCTTCACAAAG pCDM8 Invitrogen
58 pCEP Forward AGAGCTCGTTTAGTGAACCG    
59 pCMV Forward GATCCGGTACTAGAGGAACTGAAAAAC    
60 pDAB Forward ATGCCATAGCATTTTTATCC   Invitrogen
61 pET Upstream Primer ATGCGTCCGGCGTAGA (16)    
62 pETBlueDOWN Primer GTTAAATTGCTAACGCAGTCA    
63 pETBlueUP Primer TCACGACGTTGTAAAACGAC    
64 pFastBac Forward GGATTATTCATACCGTCCCA pFastBac Invitrogen
65 pFastBac Reverse CAAATGTGGTATGGCTGATT pFastBac Invitrogen
66 pGAP Forward GTCCCTATTTCAATCAATTGAA pGAPz Invitrogen
67 pGENE Forward CTGCTATTCTGCTCAACCT    
68 pGEX 3' GAGCTGCATGTGTCAGAGG Universal  
69 pGEX 5' GGCAAGCCACGTTTGGTG Universal  
70 pHook Forward ACGGTGCATTGGAACGGAC pHook-2, -3 Invitrogen
71 pHook Reverse GATTGCGTCGCATCGACCC pHook-2, -3 Invitrogen
72 pHybLex/Zeo Forward AGGGCTGGCGGTTGGGGTTATTCGC pHybLex/Zeo Invitrogen
73 pHybLex/Zeo Reverse GAGTCACTTTAAAATTTGTATACAC pHybLex/Zeo Invitrogen
74 PinPoint Sequencing primer CGTGACGCGGTGGAGGGCG PinPoint Xa-1, -2, -3, PinPoint Xa-1 T-vector Promega
75 pJET1.2 Forward CGACTCACTATAGGGAGAGCGGC    
76 pJET1.2 Reverse AAGAACATCGATTTTCCATGGCAG    
77 pJG4-5 Forward GATGCCTCCTACCCTTATGATGTGCC pJG4-5  
78 pJG4-5 Reverse GGAGACTTGACCAAACCTCTGGCG pJG4-5  
79 Polyhedrin Forward AAATGATAACCATCTCGC pVL1393 Invitrogen
80 Polyhedrin Reverse GTCCAAGTTTCCCTG (15) pVL1393 Invitrogen
81 pQE-TriSystem Forward GTTATTGTGCTGTCTCATC    
82 pQE-TriSystem Reverse TCGATCTCAGTGGTATTTGTG    
83 pREP Forward GCTCGATACAATAAAGCCC pREP4 Invitrogen
84 pRset CTAGTTATTGCTCAGCGGTGG pRset Invitrogen
85 pRH Forward CTGTCTCTATACTCCCCTATAG pRH Invitrogen
86 pRH Reverse CAAAATTCAATAGTTACTATCGC pRH Invitrogen
87 pRSET Reverse TAGTTATTGCTCAGCGGTGG pRSET Invitrogen
88 pTarget Sequencing Primer TTACGCCAAGTTATTTAGGTGACA pTarget Promega
89 pTrcHis Forward GAGGTATATATTAATGTATCG pTrcHis Invitrogen
90 pTrcHis Reverse GATTTAATCTGTATCAGG pTrcHis Invitrogen
91 pTRE 3' CCACACCTCCCCCTGAAC pTRE BD Biosciences
92 pTRE 5' CGCCTGGAGACGCCATCC pTRE  
93 pTriplEx 3' ACTCACTATAGGGCGAATTG pTriplEx Clontech
94 pTriplEx 5' CTCGGGAAGCGCGCCATTGTGTTGGT pTriplEx Clontech
95 pUni Forward CTATCAACAGGTTGAACTG pUni Invitrogen
96 pUni Reverse CAGTCGAGGCTGATAGCGAGCT pUni Invitrogen
97 pYESTrp Forward GATGTTAACGATACCAGCC pYESTrp Invitrogen
98 pYESTrp Reverse GCGTGAATGTAAGCGTGAC pYESTrp Invitrogen
99 QE Promoter CCGAAAAGTGCCACCTG pQE Qiagen
100 QE Reverse GTTCTGAGGTCATTACTGG pQE Qiagen
101 R-20mer Primer CAGCTATGACCATGATTACG pSTBlue-1 Novagen
102 RsaA Reverse GCCGCGCCAGCGACGCGGAGGG pCX Invitrogen
103 RVprimer3 CTAGCAAAATAGGCTGTCCC pGL / pCAT3 Promega
104 Rvprimer4 GACGATAGTCATGCCCCGCG pGL / pCAT3 Promega
105 SeqL-A (proximal to attL1) TCGCGTTAACGCTAGCATGGATCTC pDONR201/pDONR207 Invitrogen
106 SeqL-B (proximal to attL2) GTAACATCAGAGATTTTGAGACAC pDONR201/pDONR207 Invitrogen
107 STag 18mer Primer GAACGCCAGCACATGGAC pIEx-1 Novagen
108 STag Primer CGAACGCCAGCACATGGACA pIEx-1 Novagen
109 Sp6 Promoter GATTTAGGTGACACTATAG Universal  
110 SV40-pArev CCTCTACAAATGTGGTATGG pRL-SV40  
111 SV40-Promoter GCCCCTAACTCCGCCCATCC pRL-SV40  
112 T3 Promoter ATTAACCCTCACTAAAGGGA Universal  
113 T7 EEV ATGTCGTAATAACCCCGCCCCG pAlterMAX, pSI, pCI, pCI-Neo, pCMVTnT, pTnT, phMGFP Vector, HaloTag pHT2, psiCHECK-1, -2 Promega
114 T7 gene 10 Primer TGAGGTTGTAGAAGTTCCG    
115 T7 Promoter TAATACGACTCACTATAGGG Universal  
116 T7 Reverse TAGTTATTGCTCAGCGGTGG Universal  
117 T7 Terminator GCTAGTTATTGCTCAGCGG Universal  
118 U6 Primer GGGCAGGAAGAGGGCCTAT    
119 U-19mer Primer GTTTTCCCAGTCACGACGT M13mp18, pCITE Novagen
121 V5 Reverse Primer ACCGAGGAGAGGGTTAGGGAT V5 Epitope Invitrogen
122 VP22 Forward GGCCACGGCGACTCGA    
123 Xpress Forward TATGGCTAGCATGACTGGT Xpress Epitope Invitrogen
124 VLH TTGTGTGGAATTGTGAGCGG    
125 VF2 TGCCACCTGACGTCTAAGAA    
126 VR ATTACCGCCTTTGAGTGAGC    
127 TKpA Rev CTTCCGTGTTTCAGTTAGC    
128 pQE60-FW CCCGAAAAGTGCCACCTG    
129 pQE60-Rv GTTCTGAGGTCATTACTGG    
130 SeqL-A (ATTL1) GCGAGAGTAGGGAACTGC pENTR Invitrogen
131 SeqL-B (ATTL2) AACATCAGAGATTTTGAGACAC pENTR Invitrogen
132 pmirGlo F (7205bp) GAGGTGCCTAAAGGACTGAC pmirGlo promega
There is no documents for this product.Will be available soon.
The Q&A for this product will be available soon.
Customized Competent <i>E. coli</i>
NanoPOP™ Polymers
Dh5-Alpha Competent  <em>E. coli </em>
Customized Competent E. coli NanoPOP™ Polymers Dh5-Alpha Competent E. coli
$550.00
$110.00
$110.00
 
2X  HoTaq&trade; One-Step Real-Time RT-PCR Kit For TaqMan<sup>&reg;</sup>
2X HotStart PCR Master Mix
T4 DNA Ligase
2X HoTaq™ One-Step Real-Time RT-PCR Kit For TaqMan® 2X HotStart PCR Master Mix T4 DNA Ligase
$50.00
$60.00
$100.00
 
T7 RNA Polymerase
CHAPS
Bst DNA Polymerase (regular)
T7 RNA Polymerase CHAPS Bst DNA Polymerase (regular)
$100.00
$88.00
$120.00