Primers for Sequencing
Primers for Sequencing

100+ universal primers for sequencing. Free for customers using MCLAB's sequencing services.
Download Fasta File          


Primer Name & Sequence
Name Cat# Description Price Qty
MCLAB Primers
Please input your Primer Name and Sequence in the filed above.

If you are using MCLAB's DNA sequencering services, you do not need to purchase or submit any primers listed here in your orders. You only need to specify the primer names in your order form and MCLAB will take care of everything related to these primers.

MCLAB Primers

MC Easy Depository™ for DNA Sequencing Guidelines
We provide custom with oligonucleotide synthesis service in combination of our DNA sequencing service to better assist our customers. First time primer synthesis order will be fulfilled within 24 hours. Once the primers are synthesized, we aliquot them for the DNA sequencing and save the rest in the MC Easy Depository™for possible future usage from our customers. So that the next time when you order the sequencing using the same primers, you will save time and money by choosing the primers we saved for you in the MC Easy Depository ™. This is a complete free service from us to say thank to our customers.

We also provide our customers with free templates and primers storage in MCLAB's freezer archives for up to 1 months from the time of submission. This way when you order a re-sequencing or submit other templates to be sequenced by the same group of primers, what you need to do is just tell us which primer combination to use. It's just like that easy.

Customers could also get their DNA templates and/or primers back by simply include such instruction in the online order form when submitting their sequencing requests to MCLAB. It's like that simple.


MC Free Primers™ for DNA Sequencing Service

# Primer Sequences (5'd ~ 3') Plasmid Manufacturer
1 28 glll GTATGGGATTTTGCTAAACAAC Ph.D. glll New England Biolabs
1a -96 glll CCCTCATAGTTAGCGTAACG Ph.D. glll New England Biolabs
2 Ac5 Forward ACACAAAGCCGCTCCATCAG pAc5.1/V5-His Invitrogen
4 a-Factor TACTATTGCCAGCATTGCTGC Pichia (pMET) Invitrogen
5 AOX1 Forward GACTGGTTCCAATTGACAAGC Pichia Invitrogen
6 AOX1 Reverse GCAAATGGCATTCTGACATCC Pichia Invitrogen
8 AS SoTag 18mer Primer GTCCATGTGCTGGCGTTC pIEx Novagen
10 AUG1 Reverse GAAGAGAAAAACATTAGTTGGC Pichia Invitrogen
11 Bac Forward TTTTACTGTTTTCGTAACAGTTTT pBlueBac4.5 Invitrogen
12 Bac Reverse CGGATTTCCTTGAAGAGAGTA pBlueBacHis2 Invitrogen
13 Baculovirus (+15)Reverse ACTTCAAGGAGAATTTCC pMelBac Invitrogen
17 Bluescript KS TCGAGGTCGACGGTATC pBluescript Stratagene
18 Bluescript SK CGCTCTAGAACTAGTGGATC pBluescript Stratagene
22 cI Forward GGATAGCGGTCAGGTGTT pHybcI/HK Invitrogen
25 CYC1 Reverse GCGTGAATGTAAGCGTGAC Cyc1 Invitrogen
40 gp64 Signal primer GCGCTATTGTTTTATATGTGC    
41 IE1 promoter primer TGGATATTGTTTCAGTTGCAAG pIEx, pBIEx Novagen
44 Lamdagt11For GGTGGCGACGACTCCTGGAGCCCG Lambda GT11 Promega
45 Lamdagt11Rev TTGACACCAGACCAACTGGTAATG Lambda GT11 Promega
46 M13 Forward (-20) GTAAAACGACGGCCAG Universal  
47 M13 Forward (-40) GTTTTCCCAGTCACGAC Universal  
47b M13 Reverse CAGGAAACAGCTATGAC Universal  
50 MT Forward CATCTCAGTGCAACTAAA pMT/V5-His Invitrogen
52 OpIE2 Forward CGCAACGATCTGGTAAACAC pMIB/V5-His Invitrogen
54 p10 Forward GTATATTAATTAAAATACTATACTG pTriEx-2 Hygro Novagen
55 pBAD Forward ATGCCATAGCATTTTTATCC E.coli araBAD Invitrogen
56 pBAD Reverse GATTTAATCTGTATCAGG E.coli araBAD Invitrogen
57 pCDM8 Reverse TAAGGTTCCTTCACAAAG pCDM8 Invitrogen
61 pET Upstream Primer ATGCGTCCGGCGTAGA (16)    
64 pFastBac Forward GGATTATTCATACCGTCCCA pFastBac Invitrogen
65 pFastBac Reverse CAAATGTGGTATGGCTGATT pFastBac Invitrogen
70 pHook Forward ACGGTGCATTGGAACGGAC pHook-2, -3 Invitrogen
71 pHook Reverse GATTGCGTCGCATCGACCC pHook-2, -3 Invitrogen
72 pHybLex/Zeo Forward AGGGCTGGCGGTTGGGGTTATTCGC pHybLex/Zeo Invitrogen
73 pHybLex/Zeo Reverse GAGTCACTTTAAAATTTGTATACAC pHybLex/Zeo Invitrogen
74 PinPoint Sequencing primer CGTGACGCGGTGGAGGGCG PinPoint Xa-1, -2, -3, PinPoint Xa-1 T-vector Promega
79 Polyhedrin Forward AAATGATAACCATCTCGC pVL1393 Invitrogen
80 Polyhedrin Reverse GTCCAAGTTTCCCTG (15) pVL1393 Invitrogen
81 pQE-TriSystem Forward GTTATTGTGCTGTCTCATC    
88 pTarget Sequencing Primer TTACGCCAAGTTATTTAGGTGACA pTarget Promega
89 pTrcHis Forward GAGGTATATATTAATGTATCG pTrcHis Invitrogen
90 pTrcHis Reverse GATTTAATCTGTATCAGG pTrcHis Invitrogen
93 pTriplEx 3' ACTCACTATAGGGCGAATTG pTriplEx Clontech
95 pUni Forward CTATCAACAGGTTGAACTG pUni Invitrogen
96 pUni Reverse CAGTCGAGGCTGATAGCGAGCT pUni Invitrogen
101 R-20mer Primer CAGCTATGACCATGATTACG pSTBlue-1 Novagen
104 Rvprimer4 GACGATAGTCATGCCCCGCG pGL / pCAT3 Promega
105 SeqL-A (proximal to attL1) TCGCGTTAACGCTAGCATGGATCTC pDONR201/pDONR207 Invitrogen
106 SeqL-B (proximal to attL2) GTAACATCAGAGATTTTGAGACAC pDONR201/pDONR207 Invitrogen
107 STag 18mer Primer GAACGCCAGCACATGGAC pIEx-1 Novagen
109 Sp6 Promoter GATTTAGGTGACACTATAG Universal  
112 T3 Promoter ATTAACCCTCACTAAAGGGA Universal  
113 T7 EEV ATGTCGTAATAACCCCGCCCCG pAlterMAX, pSI, pCI, pCI-Neo, pCMVTnT, pTnT, phMGFP Vector, HaloTag pHT2, psiCHECK-1, -2 Promega
114 T7 gene 10 Primer TGAGGTTGTAGAAGTTCCG    
115 T7 Promoter TAATACGACTCACTATAGGG Universal  
116 T7 Reverse TAGTTATTGCTCAGCGGTGG Universal  
117 T7 Terminator GCTAGTTATTGCTCAGCGG Universal  
119 U-19mer Primer GTTTTCCCAGTCACGACGT M13mp18, pCITE Novagen
120 M13 Reverse CAGGAAACAGCTATGAC Universal  
121 V5 Reverse Primer ACCGAGGAGAGGGTTAGGGAT V5 Epitope Invitrogen
123 Xpress Forward TATGGCTAGCATGACTGGT Xpress Epitope Invitrogen
132 pmirGlo F (7205bp) GAGGTGCCTAAAGGACTGAC pmirGlo promega


There is no documents for this product.Will be available soon.
The Q&A for this product will be available soon.
Lyse-load solution (5x1ml)
Customized Competent <i>E. coli</i>
BL21(DE3) Competent <i>E. coli</i>
Lyse-load solution (5x1ml) Customized Competent E. coli BL21(DE3) Competent E. coli
HB101 Competent <i>E. coli</i>
BL21(DE3)pLysS Competent <i>E. coli</i>
Dh5-Alpha Competent  <em>E. coli </em>
HB101 Competent E. coli BL21(DE3)pLysS Competent E. coli Dh5-Alpha Competent E. coli
T4 DNA Ligase
Exonuclease I (<i>E. coli</i>)
<em>Taq</em> DNA Polymerase
T4 DNA Ligase Exonuclease I (E. coli) Taq DNA Polymerase